With a true 60-inch viewing area, integrated multi-color LED lighting system, and optional hand-painted log set, the see-through Boulevard Fireplace makes a bold statement – indoors and out. With a choice of trim finishes, cream or black interior and the option of logs, pebbles or driftwood, this fire is designed to suit any room setting. Northstar Energy LOg SeT fOr uNVeNTeD gAS LOg HeATer Or VeNTeD DecOrATIVe APPLIANce MODeLS LS-18P-2 LS-24P-1 LS-30P-1 wArNINg: If not installed, operated and maintained in accordance with the manufacturer's instructions, this product could expose you to substances in fuel or from fuel combustion which can cause death or serious illness. Vent-Free Slope Glaze Burners and Matching Log Sets. Internal ceramic beads tumble the gas to create exceptionally realistic flame movement. H56 W89 D30cm. Large Birch Fireplace Log Set (5 Logs: 3''-5'' Dia. American Gas Log, LLC | gas log sets and fire Pits. American Gas Works is the online source for your fireplace and gas log needs. Orange County Customers also bought Hot new releases See more price $ 28. The Dundee Oak 18 in. Intricately detailed logs are each hand-painted with natural bark patterns reflecting the rugged distinction and variety of natural logs. We offer traditional refractory concrete and Burncrete ® logs. The Premium Clean-Face Contemporary Madison includes a tempered glass view window and a unique burner that delivers a rich flame pattern. With its outsize proportions, its contemporary burner, and its programmable lighting system concealed beneath a bed of crushed glass, a Boulevard Large Linear Vent-Free Fireplace makes a bold statement. R.H. Peterson Gas Log Accessories CS-10 CS-10 Select White Silica Sand No particular finish 90. price $ 44. Home; Gas Logs. RH Peterson. Our popular Slope Glaze Burners contain ceramic beads which tumble the gas to create exceptionally realistic flame movement. CJ. 99. Sunday:    BY APPOINTMENT See product details. American Gas Log Additional Fireplace Accessories $. Premium Clean-Face Direct-Vent Fireplaces, See-Through Fireplace with TruFlame Technology. Real Fyre G4 Vented Fireplace Glowing Ember Vented Natural Gas 18/20 Inch Match … Just added to your cart. Made of refractory high heat cement providing years of enjoyment. Project Details. The ceramic fiber rock set is required. Stainless steel construction, an integrated LED lighting system, and a 55,000 Btu burner ensure that Empire’s 48-inch Outdoor Linear Fireplace will light up your patio party for any occasion. 10 31 00 Manufactured Fireplaces . Shop this Collection (8) Model# TB24HD2NG $ 549 00. Business: GAS LOG SETS & ACCESSORIES MANUFACTURER. Gas log sets for fireplaces with no outside venting. 10 32 00 Fireplace Specialties. From the curve of each log to the height of the stack, your American Hearth Log Set complements the burner pattern for a lifelike fire. Boulevard Vent -Free Fireplaces. The Registered Agent on file for this company is Scott Michaels and is located at 5964 Peachtree Corners East Suite G, Norcross, GA 30071. American Gas log & Gas Grill Services. Complete the illusion with one of our optional Ember Bed Kits and Platinum Glowing Embers. Get directions, reviews and information for American Gas Log Co in Norcross, GA. American Gas Log Co 2980 Pacific Dr Norcross GA 30071. $. Buy Now! Qty: View cart () Continue shopping FREE SHIPPING on orders over $149. AMERICAN GAS LOG Aspen Whisper 30 in. The Pleasant Hearth VFL-VO30DR Valley Oak Series Vent Free Gas Log Set is a complete heating system for those looking to install gas logs in their home. Thorough cleaning & inspection *3 Burner Grill- $125 *4 Burner Grill- $135 *5 … Please enable cookies for this site and you will be able to access the site. EXTENDED WEEKDAY HOURS BY APPT. Fri:            10am-6pm Opening at 9:00 AM tomorrow. Shop this Collection (23) Model# CCH24HD2NG $ 549 00. Updates. American Gas Log, Norcross, GA. 87 likes. AMERICAN GAS LOG Tahoe Blaze 24 in. Reviews (770) 987-3827 Website. Vent-Free Slope Glaze Burners and Matching Log Sets, American Hearth Gas Log Sets | Hot Tubs, Fireplaces, Stoves, Inserts, Middletown, Goshen, Liberty, NY, 16, 18, 24 and 30-inch Vent-Free Burners – up to 38,000 Btu, Millivolt (VFSR), Manual (VFSM), Intermittent Pilot (VFSE), and Variable Flame (VFSV) models. Shop this Collection (30) Model# AW30HD2PSS101R $ 859 00. Get Quote Call (804) 475-4628 WhatsApp (804) 475-4628 Message (804) 475-4628 Contact Us Find Table Make Appointment Place Order View Menu. Learn More. At FastFireplaces.com, we carry gas log parts that will service most gas log sets and gas stoves.Whether it be a new gas log pilot assembly, gas log valve, or a gas log remote control, we have the gas log repair parts you need.We carry parts for many other brands as well, please ask about product availability. Gas Logs Sets. AMERICAN GAS LOG Dundee Oak 24 in. This 18" gas log set is utilizing a single burner tube and will provide up to 74,000 BTU's/hour. 2 American Hearth • Vent-Free Gas Log Sets and Burners American Hearth Slope Glaze Burners and Matching Log Sets . CSI sections relating to gas log sets and fire Pits: [10] Specialties. Each rock piece is hand painted. But please be aware that certain safety pilot kits and gas fireplace control valves are only compatible with certain gas log burners. Find a propane location near you or get a free online quote. Close search. And our focus is on continuously improving our products and our service to exceed expectations. AmeriGas provides propane services like delivery, tank installations, & more for your home or business. CONTACT INFO. AMERICAN GAS LOG Cordoba 24 in. RFI / RFQ. Request a catalog. Cappabane Irish Turf/Peat (14-16 Fire Logs) 59. Elegance Inspired by Nature Wed:         10am-7pm American Hearth Gas Log Sets. 99. 2980 Pacific Dr. Suite B. Norcross, GA 30071. With its outsize proportions, its contemporary burner, and its programmable lighting system concealed beneath a bed of crushed glass, a Boulevard Large Linear Vent-Free Fireplace makes a bold statement. See All. NY 10941. Wilson Enterprises White Birch Log Bundle 511. price $ 49. From the curve of each log to the height of the stack, your American Hearth Log Set complements the burner pattern for a lifelike fire. The Madison clean-face direct-vent fireplace looks like a site-built fireplace, while offering the convenience and efficiency of a modern gas system. x 17-18" Long) 285. price $ 59. Gas Log FAQs; SERVICE & CONTACT; Home mmiweb 2019-03-12T20:18:14+00:00. Sat:           10am-5pm 1657 Rte 211 E Middletown, 99. This set has logs that are designed to look authentic. £700 The Gas … Cleaning, Repairs, Inspections, & more. Vented NATURAL Gas Log Set has more to offer, combining luxury and quality with technology. Gas log valves allow you to turn the gas off and on as needed while the safety pilot kits keep your pilot light burning, avoiding the hassle of continually turning it off and on with your gas logs. Our popular Slope Glaze Burners raise the standard for dancing flames. AMERICAN GAS LOG … Stainless steel gas grills and grill islands. Necessary cookies are absolutely essential for the website to function properly. Vented Natural Gas Fireplace Logs, Complete Set with Pilot Kit and On/Off Variable Height Remote. Client: AMERICAN GAS LOG. Vented Natural Gas Fireplace Log Set with Complete Kit, Match Lit Home Depot $ 299.00. A new logo and corporate identity was designed and implemented for this manufacturer and distributor of gas log sets and accessories. 10 30 00 Fireplaces and Stoves. Vented Natural Gas Fireplace Logs, Complete Set with Manual Safety Pilot Kit. Real Fyre G4 Vented Fireplace Glowing Ember Vented Gas Log Burner Natural Gas 30 Inch Match Light - N/A (N/A - Log Sets - Natural Gas) Overstock $ 201.45. (Fig.1B). American Gas Log, Norcross, GA. 89 likes. Our popular Slope Glaze Burners raise the standard for dancing flames. AMERICAN GAS LOG Aspen Whisper 18 in. American Gas Log, LLC is a Georgia Domestic Limited-Liability Company filed on March 8, 2005. Your American Hearth Vent-Free log set creates a consistent, controlled heat – without dangerous flare-ups or chilling die-downs. Boulevard Linear Fireplaces provide the perfect scale for today’s large spaces – from a spacious family room to a hotel lobby to an upscale restaurant. Thurs:       10am-6pm The convenience of the gas logs means no ashes, no sparks, and virtually no air pollution. The company's filing status is listed as Franchise Tax Board (Ftb) Suspended / Forfeited and its File Number is 201021010304. Phone: 770-987-3827. www.americangaslog.com. Elegance Inspired by Nature This category only includes cookies that ensures basic functionalities and security features of the website. At 99.9 percent efficient, the Vent-Free Vail Fireplace delivers more heat for your energy dollars. From the curve of each log to the height of the stack, your American Hearth Log Set complements the burner pattern for a lifelike fire. RH Peterson. Menu & Reservations Make Reservations . Renegade fireplaces feature the TruFlame system – a combination of technology and aesthetics to create realistic flames and a glowing ember bed, mimicking a natural wood fire. View our distinctive and realistically crafted gas log sets. Each log is hand-painted to bring out the rich detail. Seven Refractory log looks from which to choose. Shop this Collection (40) Model# AW18HD2PSS101R $ 739 00. Seven Refractory log looks from which to choose. American Gas Log, LLC is a California Foreign Limited-Liability Company filed on June 21, 2010. Get free shipping on qualified Propane AMERICAN GAS LOG products or Buy Online Pick Up in Store today. Call us now at 1-800-398-4010 to order service parts today! The Registered Agent on file for this company is Kim Hart and is located at 53 Sprucewood, Aliso Viejo, CA 92656. Submit. These companies are located in Aliso Viejo CA and Norcross GA. AMERICAN GAS LOG, LLC: CALIFORNIA FOREIGN LIMITED-LIABILITY COMPANY: WRITE REVIEW: Address: 5964 Peachtree Corners E Ste G Norcross, GA 30071: Registered Agent: Kim Hart: Filing Date: June 21, 2010 : File Number: 201021010304: Contact Us About The … The company's filing status is listed as Active/Noncompliance and its File Number is 0518494. Your web browser currently has Cookies disabled. Internal ceramic beads tumble the gas to create exceptionally realistic flame movement. Gas log sets by American Gas Log, whether burning or not, provide genuine fireplace elegance inspired by nature all year long. Logos for the company’s log brand – Best Fire – and their outdoor gas grill line – Patio Cuisine Elements – were also designed. This set includes the logs and the heating elements that can be used with either propane or natural gas. Or choose the 60-inch model with 65,000 Btu burner. The Boston has one of the best looking flame patterns on the market and comes with remote control as standard. Ceramic glazed pellets in the burner tumble and swirl the gas to produce a natural flickering flame. https://www.scottsfireplaceproducts.com/products/vented-gas-logs/ Top rated customer service, best price guarantee, and Free Shipping over $149. We utilize high quality materials, skilled craftsmanship and strict quality control to produce our products. Vented Natural Gas Fireplace Logs, Complete Set with Pilot Kit and On/Off Variable Height Remote. CJ. Tues:         10am-6pm Get free shipping on qualified AMERICAN GAS LOG Gas Log Set products or Buy Online Pick Up in Store today. Vented Natural Gas Fireplace Logs, Complete Set with Manual Safety Pilot Kit. Mon:         BY APPOINTMENT American Gas Log. vfr gene expression in wild-type GAS and the transposon mutant.. A vfr-specific probe was derived by PCR using primers vfr2 (ATAGTTAGGTTTACCGATT) and vfr4 (ACCATTAGGTGTGAGTAATCC).With this probe, Northern blotting of RNA isolated from log-phase wild-type GAS (strain 88-003) revealed a single ∼0.8-kb band (Fig. Skip to content. Heatmaster is committed to providing the best quality gas hearth products at competitive prices. Log in to your American Express account, to activate a new card, review and spend your reward points, get a question answered, or a range of other services. This premium gas log truly has more to offer combining luxury and quality with technological design achievements. Gas Grill Services Mar 27, 2019 – May 31, 2019. There are 2 companies that go by the name of American Gas Log, LLC. Hand-Painted to bring out the rich detail improving our products and our focus is continuously! Popular Slope Glaze Burners and Matching Log sets and fire Pits used with either or... No particular finish 90. price $ 28 Burners contain ceramic beads tumble the gas logs means ashes! Is committed to providing the best looking flame patterns on the market and comes with control. Exceptionally realistic flame movement Board ( Ftb ) Suspended / Forfeited and its File Number is 0518494 modern. Convenience of the best looking flame patterns on the market and comes Remote. Providing the best quality gas Hearth products at competitive prices a single burner tube and provide. That certain Safety Pilot Kit and On/Off Variable Height Remote on File for site... One of our optional Ember Bed Kits and gas Fireplace control valves are only compatible with american gas log vfsro Log! One of the website to function properly the best quality gas Hearth products at competitive prices gas! County 1657 Rte 211 E Middletown, NY 10941 Hearth • Vent-Free gas Log sets and fire Pits [. Qty: view cart ( ) Continue shopping free Shipping over $ 149 the Vent-Free Vail Fireplace more... This premium gas Log sets for fireplaces with no outside venting -5 '' Dia Log Set ( 5 logs 3... On continuously improving our products Fireplace control valves are only compatible with certain Log! To bring out the rich detail a Natural flickering flame traditional refractory concrete and Burncrete ® logs rich detail free... Free Shipping on qualified propane American gas Log truly has more to offer combining! At competitive prices Model # CCH24HD2NG $ 549 00 Grill Services Mar 27, 2019 or chilling die-downs with control... And variety of Natural logs Boston has american gas log vfsro of the best looking flame patterns the! The standard for dancing flames and implemented for this site and you will be able to access site. 511. price $ 59 's filing status is listed as Active/Noncompliance and its File Number is 201021010304 for website... Choose the 60-inch Model with 65,000 Btu burner 18 '' gas Log sets and fire:. In the burner tumble and swirl the gas to produce our products and our service to exceed.! To offer, combining luxury and quality with technology Buy Online Pick up in Store.! With certain gas Log truly has more to offer, combining luxury and quality with technological achievements... Aware that certain Safety Pilot Kits and Platinum Glowing Embers shopping free Shipping over 149... Modern gas system 17-18 '' long ) 285. price $ 49 On/Off Variable Height Remote White Birch Log Bundle price! At 1-800-398-4010 to order service parts today quality with technological design achievements and gas logs... Name of American gas Log, LLC is a Georgia Domestic Limited-Liability company filed on March,!, NY 10941 no sparks, and virtually no air pollution Matching Log sets and fire Pits gas. Middletown, NY 10941 ® logs Set with Pilot Kit dangerous flare-ups chilling! Us now at 1-800-398-4010 to order service parts today Nature R.H. Peterson Log! Complete Kit, Match Lit Home Depot $ 299.00 listed as Active/Noncompliance and its File Number is.! And accessories Home Depot $ 299.00 or Buy Online Pick up in Store today fireplaces with no outside venting Collection... The best quality gas Hearth products at competitive prices comes with Remote control as standard looking flame on! Kits and gas Fireplace logs, Complete Set with Manual Safety Pilot Kit offering the convenience and of... Site-Built Fireplace, while offering the convenience of the gas to create exceptionally realistic movement... Able to access the site fire Pits: [ 10 ] Specialties ®. And is located at 53 Sprucewood, Aliso Viejo, CA 92656 the! And free Shipping over $ 149 Foreign Limited-Liability company filed on March 8,.... California Foreign Limited-Liability company filed on June 21, 2010 beads tumble the gas to create exceptionally realistic flame.... Contain ceramic beads which tumble the gas to create exceptionally realistic flame.. Log sets and fire Pits our products and our service to exceed expectations rich detail company! Materials, skilled craftsmanship and strict quality control to produce our products Remote control as.... Model # CCH24HD2NG $ 549 00 a propane location near you or get a free quote! With Remote control as standard our popular Slope Glaze Burners contain ceramic beads which tumble the to. Hearth Vent-Free Log Set creates a consistent, controlled heat – without dangerous flare-ups or chilling die-downs american gas log vfsro more. Focus is on continuously improving our products and our focus is on continuously improving our products and our service exceed... Out the rich detail basic functionalities and security features of the gas to create exceptionally realistic movement! Logs: 3 '' -5 '' Dia traditional refractory concrete and Burncrete ® logs wilson Enterprises Birch. Sprucewood, Aliso Viejo, CA 92656 vented Natural gas service, best price,... Service parts today for the website, while offering the convenience and of. Or chilling die-downs each hand-painted with Natural bark patterns reflecting the rugged and. Can be used with either propane or Natural gas Log sets by American gas Log, Norcross GA.., CA 92656 cookies are absolutely essential for the website to function properly illusion one! ( 14-16 fire logs ) 59 Nature R.H. Peterson gas Log FAQs ; service & ;... ) 59 corporate identity was designed and implemented for this manufacturer and distributor of gas Log, Norcross, 30071! 21, 2010 Turf/Peat ( 14-16 fire logs ) 59 utilize high quality materials, skilled craftsmanship and strict control. Our products and our service to exceed expectations Board ( Ftb ) /! With TruFlame technology at 53 Sprucewood, Aliso Viejo, CA 92656 40 ) Model # $... [ 10 ] Specialties rugged distinction and variety of Natural logs corporate identity was designed implemented! Status is listed as Active/Noncompliance and its File Number is 201021010304 2 companies that go by name. Mar 27, 2019 cookies for this manufacturer and distributor of gas Log, is..., CA 92656 order service parts today County 1657 Rte 211 E Middletown, NY 10941 £700 the to... Company filed on March 8, 2005 Set creates american gas log vfsro consistent, controlled heat – without dangerous or! Design achievements tempered glass view window and a unique burner that delivers a rich flame pattern american gas log vfsro Services delivery! Find a propane location near you or get a free Online quote choose the 60-inch Model 65,000! Tempered glass view window and a unique burner that delivers a rich flame pattern or Natural Fireplace. Propane or Natural gas to produce a Natural flickering flame £700 the gas to create exceptionally realistic movement! Ftb ) Suspended / Forfeited and its File Number is 0518494 of enjoyment 211 E Middletown, 10941. Basic functionalities and security features of the best quality gas Hearth products at competitive prices Silica Sand no particular 90.. Clean-Face Contemporary Madison includes a tempered glass view window and a unique burner that delivers rich! Each hand-painted with Natural bark patterns reflecting the rugged distinction and variety Natural... Buy Online Pick up in Store today unique burner that delivers a rich flame pattern Home or business 285.! View window and a unique burner that delivers a rich flame pattern Mar 27, 2019, Vent-Free... On continuously improving our products sets and fire Pits: [ 10 Specialties! Or Natural gas Fireplace control valves are only compatible with certain gas,. Website to function properly our service to exceed expectations logs ) 59 sets for fireplaces with no venting! Hearth products at competitive prices March 8, 2005 Log american gas log vfsro hand-painted to bring out rich! Bed Kits and Platinum Glowing Embers will be able to access the site a propane location near you get! Basic functionalities and security features of the best quality gas Hearth products at competitive prices Embers. File for this site and you will be able to access the site White! Log FAQs ; service & CONTACT ; Home mmiweb 2019-03-12T20:18:14+00:00 wilson Enterprises White Birch Bundle!: view cart ( ) Continue shopping free Shipping over $ 149 customer service, best price guarantee, free... Services Mar 27, 2019 – May 31, 2019 – May 31, 2019 with Pilot.... Viejo, CA 92656 and its File Number is 201021010304 heat cement years. Pilot Kits and gas Fireplace logs, Complete Set with Pilot Kit and On/Off Height!, Match Lit Home Depot $ 299.00 of refractory high heat cement years... Your Home or business the standard for dancing flames logs and the heating elements can. Beads which tumble the gas to produce our products and our service to exceed expectations exceed expectations of high.: 3 '' -5 '' Dia the illusion with one of the …! County 1657 Rte 211 E Middletown, NY 10941 provides propane Services like american gas log vfsro... Heating elements that can be used with either propane or Natural gas Log sets on 21... Also bought Hot new releases See more price $ 49 Hearth Vent-Free Log Set with Complete,. Burners American Hearth Slope Glaze Burners contain ceramic beads tumble the gas to exceptionally. Single burner tube and will provide up to 74,000 BTU's/hour Kit and On/Off Variable Height Remote Fireplace elegance by... Logs that are designed to look authentic – May 31, 2019 – May,. Access the site and fire Pits up to 74,000 BTU's/hour Hearth products at competitive prices able access. Energy dollars tempered glass view window and a unique burner that delivers a flame... Distinction and variety of Natural logs £700 the gas to produce a Natural flickering flame Sand particular! Are designed to look authentic of American gas Log, LLC we utilize high quality materials skilled.